Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250594

Morpholino Name: vps35 MO1
Synonyms: Vps35
Target mRNA: vps35

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACTGCTGGGTCGTGGGCATCATC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 21/25
genome
MO
5' GTTATAGCCCACGACCCAGCAGTCC 3'
   | |   |||||||||||||||||||
3' CTACTACGGGTGCTGGGTCGTCAGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:66456543..66456567 21/25 Antisense target vps35.L
Publications
First: Xenopus Wntless and the retromer complex cooperate to regulate XWnt4 secretion., Mol Cell Biol 2009    
Most recent: The Sorting Nexin 3 Retromer Pathway Regulates the Cell Surface Localization and Activity of a Wnt-Activated Polycystin Channel Complex., J Am Soc Nephrol 2017  
View All Papers