Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250605

Morpholino Name: wnt11 MO1
Synonyms: WntR MO1, wnt11, wnt11r MO
Target mRNA: wnt11

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCATCTTCAAAACCCAATAACAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' TTGTTATTGGGGTTTAAAGATGAAG 3'
   ||||||||||| ||| |||||||||
3' AACAATAACCCAAAACTTCTACTTC 5'
5' TTGTTATTGGGTTTTGAAGATGAAG 3'
   |||||||||||||||||||||||||
3' AACAATAACCCAAAACTTCTACTTC 5'
5' TTGTTATTGGGTTTTGAAGATGAAG 3'
   |||||||||||||||||||||||||
3' AACAATAACCCAAAACTTCTACTTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:185224033..185224057 25/25 Antisense target wnt11.L
Chr2S:164172488..164172512 25/25 Antisense target wnt11.S
Chr3L:44451094..44451118 22/25 Antisense off-target rad50.L
Chr3S:79274016..79274040 22/25 Sense off-target LOC108712359
Chr4L:113165249..113165273 21/25 Sense off-target l3mbtl2.L
Chr6L:158885842..158885866 21/25 unknown
Chr6S:130777972..130777996 21/25 unknown
Chr7L:134009923..134009947 21/25 unknown
Chr9_10L:58255853..58255877 21/25 unknown
tropicalis 10.0 Chr2:173068271..173068295 23/25 Antisense target wnt11
Chr7:64877669..64877693 22/25 Antisense off-target exosc10
Publications
First: Wnt11-R, a protein closely related to mammalian Wnt11, is required for heart morphogenesis in Xenopus., Dev Biol 2005            
Most recent: The CapZ interacting protein Rcsd1 is required for cardiogenesis downstream of Wnt11a in Xenopus laevis., Dev Biol 2017                                    
View All Papers