Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250681

Morpholino Name: zmym3 MO1
Synonyms: Wnt11-R MO, Wnt11-R MO2
Target mRNA: zmym3

Morpholino Type: uncategorized morpholino
Sequence: 5' AAACCCAATAACAAATAAATTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 20/23
genome
MO
5' TAAATTTATTTGATATTTGGTCT 3'
   |||||||||||| |||| ||| |
3' ATTTAAATAAACAATAACCCAAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:10483439..10483461 21/23 Antisense off-target dscam.L
Chr9_10L:116382495..116382517 21/23 Antisense off-target dnaaf8.L
Chr3L:52587246..52587268 20/23 Sense off-target hrh2.L
Chr3S:101952776..101952798 20/23 Sense off-target hrh2.S
Chr4L:29529093..29529115 20/23 Antisense off-target dpp3.L
Chr4S:30857149..30857171 20/23 Antisense off-target tox3.S
Chr2S:19937616..19937638 20/23 Antisense off-target il10rb.S
Chr4L:29529093..29529115 20/23 Sense off-target mrpl11.L
Chr9_10L:100997354..100997376 20/23 Antisense off-target shisa9.L
Chr1S:24660998..24661020 20/23 Antisense off-target LOC108706563
Chr2L:163999014..163999036 20/23 Antisense off-target LOC108708699
Chr5S:42656603..42656625 19/23 Antisense off-target cnst.S
Chr6S:126428833..126428855 19/23 Antisense off-target cat2.S
Chr6S:21731217..21731239 19/23 Antisense off-target rsu1.S
Chr2L:185224024..185224046 19/23 Antisense off-target wnt11.L
Chr2S:164172479..164172501 19/23 Antisense off-target wnt11.S
Chr2S:127209614..127209636 19/23 Sense off-target kansl2.S
Chr4L:112292238..112292260 19/23 Antisense off-target rbfox2.L
Chr6S:43117858..43117880 19/23 Antisense off-target topaz1.S
Chr2L:49762689..49762711 19/23 Sense off-target rap1gap2.L
Chr4S:83424206..83424228 19/23 Sense off-target arhgap29.S
Chr6L:33529326..33529348 19/23 Antisense off-target slc25a13.L
Chr5S:42656603..42656625 19/23 Sense off-target LOC121394196
Chr7L:95842793..95842815 19/23 Sense off-target LOC108696552
Chr8L:23469829..23469851 19/23 Sense off-target LOC108698296
Chr8S:69169599..69169621 19/23 Antisense off-target LOC108700145
Chr9_10L:136943302..136943324 19/23 Antisense off-target LOC108704740
Chr9_10L:86296637..86296659 19/23 Sense off-target LOC108701858
Chr1S:161955128..161955150 21/23 unknown
Chr3L:78623456..78623478 21/23 unknown
Chr4L:8630191..8630213 21/23 unknown
Chr5S:100811028..100811050 21/23 unknown
Chr1L:4386012..4386034 20/23 unknown
Chr1S:198769355..198769377 20/23 unknown
Chr3L:48264291..48264313 20/23 unknown
Chr3S:106145938..106145960 20/23 unknown
Chr3S:92735021..92735043 20/23 unknown
Chr4L:123700074..123700096 20/23 unknown
Chr5S:28423007..28423029 20/23 unknown
Chr1L:156638009..156638031 19/23 unknown
Chr1L:165377219..165377241 19/23 unknown
Chr1L:191707742..191707764 19/23 unknown
Chr1L:230809968..230809990 19/23 unknown
Chr1L:44992442..44992464 19/23 unknown
Chr1S:25620294..25620316 19/23 unknown
Chr2L:75865154..75865176 19/23 unknown
Chr2S:82915112..82915134 19/23 unknown
Chr3L:74809132..74809154 19/23 unknown
Chr3L:87033186..87033208 19/23 unknown
Chr3S:54437095..54437117 19/23 unknown
Chr4L:57832460..57832482 19/23 unknown
Chr5L:148159117..148159139 19/23 unknown
Chr5S:113912179..113912201 19/23 unknown
Chr6L:147224061..147224083 19/23 unknown
Chr6L:156857557..156857579 19/23 unknown
Chr7L:112399510..112399532 19/23 unknown
Chr7L:16700016..16700038 19/23 unknown
Chr8S:47213203..47213225 19/23 unknown
Chr9_10S:11414728..11414750 19/23 unknown
Chr9_10S:116858516..116858538 19/23 unknown
Chr9_10S:95246487..95246509 19/23 unknown
tropicalis 10.0 Chr8:44328292..44328314 20/23 Antisense target zmym3
Chr8:44863462..44863484 20/23 Sense off-target dlg3
Chr8:91709894..91709916 20/23 Sense off-target lrfn5
Chr7:106322343..106322365 20/23 Antisense off-target LOC100494562
Chr2:30559100..30559122 19/23 Antisense off-target aspa
Chr5:45583005..45583027 19/23 Antisense off-target utrn
Chr1:136650327..136650349 19/23 Sense off-target lrrc2
Chr1:155194531..155194553 19/23 Sense off-target arvcf
Chr5:22766384..22766406 19/23 Antisense off-target nrxn1
Chr7:54558119..54558141 19/23 Antisense off-target lrmda
Chr7:77422620..77422642 19/23 Sense off-target nxpe1
Chr9:24553699..24553721 19/23 Sense off-target dnah3
Chr3:69756411..69756433 19/23 Sense off-target ptprz1
Chr3:75159648..75159670 19/23 Antisense off-target kif21a
Chr7:33001015..33001037 19/23 Sense off-target zdhhc16
Chr9:29645853..29645875 19/23 Antisense off-target micall2
Chr1:108378037..108378059 19/23 Antisense off-target kiaa1958
Chr1:44105284..44105306 19/23 Antisense off-target cyp4v2.1
Chr1:57519261..57519283 19/23 Antisense off-target arhgap10
Chr2:146419325..146419347 19/23 Sense off-target calcoco1
Chr3:127426124..127426146 19/23 Antisense off-target adam28.4
Chr2:99666522..99666544 19/23 Antisense off-target LOC116408858
Chr5:102531317..102531339 19/23 Sense off-target LOC100485006
Chr1:158914472..158914494 20/23 unknown
Chr1:47493895..47493917 20/23 unknown
Chr2:86780712..86780734 20/23 unknown
Chr4:5850821..5850843 20/23 unknown
Chr10:34200653..34200675 19/23 unknown
Chr5:125560747..125560769 19/23 unknown
Chr6:139779203..139779225 19/23 unknown
Chr7:102437151..102437173 19/23 unknown
Chr9:75624055..75624077 19/23 unknown
Publications
First: Wnt11-R, a protein closely related to mammalian Wnt11, is required for heart morphogenesis in Xenopus., Dev Biol 2005            
Most recent: DM-GRASP/ALCAM/CD166 is required for cardiac morphogenesis and maintenance of cardiac identity in first heart field derived cells., Dev Biol 2008              
View All Papers