Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251681

Morpholino Name: bmp15 MO1
Synonyms:
Target mRNA: bmp15

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCATGCTTAGTTTGAGAGGCCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 24/25
genome
MO
5' ATGGGCCTCTCAAACCAAGCATGGC 3'
   ||||||||||||||| |||||||||
3' TACCCGGAGAGTTTGATTCGTACCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:27446774..27446798 24/25 Antisense target bmp15.L
tropicalis 10.0 Chr1:157123961..157123985 21/25 unknown
Publications
First: Bone morphogenetic protein 15 (BMP15) acts as a BMP and Wnt inhibitor during early embryogenesis., J Biol Chem 2009                          
Most recent:
View All Papers