Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251712

Morpholino Name: nedd4l MO2
Synonyms:
Target mRNA: nedd4l

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCCGCCATGGGGAGAGTTGGGGTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GCACCCCAACTCTCCCCATGGCGGC 3'
   |||||||||||||||||||||||||
3' CGTGGGGTTGAGAGGGGTACCGCCG 5'
5' GCACCCCAACTCTCCCCATGGCGGC 3'
   |||||||||||||||||||||||||
3' CGTGGGGTTGAGAGGGGTACCGCCG 5'
5' GCACCCCAACTCTCCCCATGGCGGC 3'
   |||||||||||||||||||||||||
3' CGTGGGGTTGAGAGGGGTACCGCCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:219489367..219489391 25/25 Antisense target nedd4l.L
Chr1S:189946780..189946804 25/25 Antisense target nedd4l.S
Chr1S:201114054..201114078 21/25 Sense off-target LOC121399218
Chr6S:65313424..65313448 21/25 unknown
Chr8S:30286524..30286548 21/25 unknown
tropicalis 10.0 Chr1:201925827..201925851 25/25 Antisense target nedd4l
Publications
First: NEDD4L regulates convergent extension movements in Xenopus embryos via Disheveled-mediated non-canonical Wnt signaling., Dev Biol 2014                                
Most recent: Tril dampens Nodal signaling through Pellino2- and Traf6-mediated activation of Nedd4l., Proc Natl Acad Sci U S A 2021                        
View All Papers