Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251716

Morpholino Name: ventx1.1 MO1
Synonyms:
Target mRNA: ventx1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCAATAGAGAATCCCTGTTGAACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' GGTTCAACAGGGATTCTCTATTGAC 3'
   |||||||||||||||||||||||||
3' CCAAGTTGTCCCTAAGAGATAACTG 5'
5' GGTTCAACAGGGATTCTCTATTGAC 3'
   |||||||||||||||||||||||||
3' CCAAGTTGTCCCTAAGAGATAACTG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:21791412..21791436 25/25 Antisense target ventx1.1.L
Chr7S:16918048..16918072 25/25 Antisense target ventx1.1.S
Chr7L:21748899..21748923 25/25 Antisense off-target ventx1.2.L
Chr7S:16878230..16878254 25/25 Antisense off-target ventx1.2.S
tropicalis 10.0 Chr7:26893163..26893187 25/25 Antisense target ventx1.1
Chr7:26856616..26856640 25/25 Antisense off-target ventx1.2
Chr5:9360413..9360437 21/25 Sense off-target tlr5
Publications
First: The opposing homeobox genes Goosecoid and Vent1/2 self-regulate Xenopus patterning., EMBO J 2007                
Most recent: Xbra and Smad-1 cooperate to activate the transcription of neural repressor ventx1.1 in Xenopus embryos., Sci Rep 2018                  
View All Papers