Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251721

Morpholino Name: ventx1.1 MO3
Synonyms:
Target mRNA: ventx1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CAATAGAGAATCCCTGTTGAACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' ATGGTTCAACAGGGATTCTCTATTG 3'
   |||||||||||||||||||||||||
3' TACCAAGTTGTCCCTAAGAGATAAC 5'
5' ATGGTTCAACAGGGATTCTCTATTG 3'
   |||||||||||||||||||||||||
3' TACCAAGTTGTCCCTAAGAGATAAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:21791414..21791438 25/25 Antisense target ventx1.1.L
Chr7S:16918050..16918074 25/25 Antisense target ventx1.1.S
Chr7L:21748897..21748921 25/25 Antisense off-target ventx1.2.L
Chr7S:16878228..16878252 25/25 Antisense off-target ventx1.2.S
tropicalis 10.0 Chr7:26893165..26893189 25/25 Antisense target ventx1.1
Chr7:26856614..26856638 25/25 Antisense off-target ventx1.2
Chr7:127052213..127052237 21/25 Sense off-target MGC147188
Publications
First: A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression., Development 2002          
Most recent:
View All Papers