Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251722

Morpholino Name: ventx2.1 MO4
Synonyms:
Target mRNA: ventx2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCTGTAGTAGTCCTTGTGTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 22/25
genome
MO
5' ATGAACACAAGGACTACTACAGGAA 3'
   |||||||||||||||||||||||||
3' TACTTGTGTTCCTGATGATGTCCTT 5'
5' ATGAACACAAGGACTAATACAGACA 3'
   |||||||||||||||| |||||  |
3' TACTTGTGTTCCTGATGATGTCCTT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:16928499..16928523 22/25 Antisense target ventx2.1.S
Chr7L:21807373..21807397 21/25 Antisense target ventx2.1.L
Chr7S:16903330..16903354 22/25 Antisense off-target ventx2.2.S
Chr1S:115576231..115576255 21/25 Sense off-target ptprd.S
Chr7L:21777297..21777321 21/25 Antisense off-target ventx2.2.L
tropicalis 10.0 Chr7:26905804..26905828 25/25 Antisense target ventx2.1
Chr7:26877264..26877288 25/25 Antisense off-target ventx2.2
Publications
First: A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression., Development 2002          
Most recent: Functional specificity of the Xenopus T-domain protein Brachyury is conferred by its ability to interact with Smad1., Dev Cell 2005    
View All Papers