Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251853

Morpholino Name: rbp1 MO1
Synonyms:
Target mRNA: rbp1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GTACCCGTTGAAATTAGTAGACATG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CATGTCTACTAATTTCAACGGGTAC 3'
   |||||||||||||||||||||||||
3' GTACAGATGATTAAAGTTGCCCATG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:138134466..138134490 25/25 Antisense target rbp1.L
Publications
First: Cellular retinol binding protein 1 modulates photoreceptor outer segment folding in the isolated eye., Dev Neurobiol 2010                  
Most recent: Retinol binding protein 1 affects Xenopus anterior neural development via all-trans retinoic acid signaling., Dev Dyn 2021                  
View All Papers