Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17251924

Morpholino Name: efnb3 MO1
Synonyms:
Target mRNA: efnb3

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGAAAACATGCTGATTAAAGGGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GCCCTTTAATCAGCATGTTTTCCCG 3'
   |||||||||||||||||||||||||
3' CGGGAAATTAGTCGTACAAAAGGGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:155626303..155626327 25/25 Antisense target efnb3.L
Chr9_10S:100861212..100861236 21/25 Antisense off-target sbk1.S
Chr8S:75960447..75960471 21/25 Antisense off-target wdr44.S
Chr6L:118823801..118823825 21/25 Sense off-target LOC121394723
Chr2L:19625600..19625624 21/25 unknown
Publications
First: Variable combinations of specific ephrin ligand/Eph receptor pairs control embryonic tissue separation., PLoS Biol 2014                
Most recent: Eph/ephrin signaling controls cell contacts and formation of a structurally asymmetrical tissue boundary in the Xenopus gastrula., Dev Biol 2022                          
View All Papers