Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252253

Morpholino Name: efna3 MO1
Synonyms:
Target mRNA: efna3

Morpholino Type: uncategorized morpholino
Sequence: 5' AAAGAAGCACAAACACCACAGCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ATGGCTGTGGTGTTTGTGCTTCTTT 3'
   |||||||||||||||||||||||||
3' TACCGACACCACAAACACGAAGAAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:103294737..103294761 25/25 Antisense target efna3.L
Chr6S:77274318..77274342 22/25 Antisense off-target sycp2l.S
Chr4S:59590902..59590926 21/25 Antisense off-target adgrl2.S
Chr4S:59591058..59591082 21/25 Antisense off-target adgrl2.S
Chr2L:157037755..157037779 21/25 unknown
Chr2S:167295299..167295323 21/25 unknown
Chr2S:168974414..168974438 21/25 unknown
Chr7L:110722927..110722951 21/25 unknown
Chr9_10S:72084018..72084042 21/25 unknown
tropicalis 10.0 Chr6:38976142..38976166 22/25 Antisense off-target itgb8
Chr4:85712803..85712827 21/25 Antisense off-target patj
Chr9:61250875..61250899 21/25 Sense off-target ftcd
Chr2:176937335..176937359 21/25 Sense off-target pde2a
Chr3:150729996..150730020 21/25 Antisense off-target LOC100495051
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers