Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252254

Morpholino Name: eif3a MO1
Synonyms:
Target mRNA: eif3a

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTAGACCGGCATTGCGGCAGATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25 25/25
genome
MO
5' TACCCGCCGCAATGCCGGCCTACTT 3'
   || | ||||||||||||| ||||||
3' ATAGACGGCGTTACGGCCAGATGAA 5'
5' TACCTGCCGCAATGCCGGTCTACTT 3'
   || ||||||||||||||||||||||
3' ATAGACGGCGTTACGGCCAGATGAA 5'
5' TATCTGCCGCAATGCCGGTCTACTT 3'
   |||||||||||||||||||||||||
3' ATAGACGGCGTTACGGCCAGATGAA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:3457575..3457599 25/25 Antisense target eif3a.S
Chr7L:4869543..4869567 24/25 Antisense target eif3a.L
tropicalis 10.0 Chr7:6170338..6170362 22/25 Antisense target eif3a
Chr7:2481735..2481759 22/25 Antisense off-target LOC116412127
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent: Role of the visual experience-dependent nascent proteome in neuronal plasticity., Elife 2018                      
View All Papers