Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252255

Morpholino Name: elk4 MO1
Synonyms:
Target mRNA: elk4

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCACAAAGTGATAGCACTATCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' ATGGATAGTGCTATTACTTTGTGGC 3'
   |||||||||||||| ||||||||||
3' TACCTATCACGATAGTGAAACACCG 5'
5' ATGGATAGTGCTATCACTTTGTGGC 3'
   |||||||||||||||||||||||||
3' TACCTATCACGATAGTGAAACACCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:62913303..62913327 25/25 Antisense target elk4.S
Chr2L:66715804..66715828 24/25 Antisense target elk4.L
Chr3L:57761416..57761440 22/25 Antisense off-target elk3.L
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers