Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252262

Morpholino Name: hat1 MO1
Synonyms:
Target mRNA: hat1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTCAGCCAATTTCTTTTCCATAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genome
MO
5' GCTATGGAAAAGAAATTAGCCGAGT 3'
   ||||||||||||||||| || ||||
3' CGATACCTTTTCTTTAACCGACTCA 5'
5' GCTATGGAAAAGAAATTGGCTGAGT 3'
   |||||||||||||||||||||||||
3' CGATACCTTTTCTTTAACCGACTCA 5'
5' GCTATGGAAAAGAAATTGGCCGAGT 3'
   |||||||||||||||||||| ||||
3' CGATACCTTTTCTTTAACCGACTCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:76116706..76116730 25/25 Antisense target hat1.L
Chr9_10S:66628533..66628557 24/25 Antisense target hat1.S
Chr3S:78546886..78546910 21/25 Sense off-target cadps2.S
Chr6L:33495710..33495734 21/25 Antisense off-target slc25a13.L
Chr2L:157582910..157582934 21/25 Antisense off-target LOC108708665
Chr2L:116436526..116436550 21/25 Antisense off-target LOC121400019
Chr8S:34942197..34942221 22/25 unknown
Chr2L:157661608..157661632 21/25 unknown
Chr2S:50073180..50073204 21/25 unknown
Chr2L:155673856..155673880 21/25 unknown
Chr2L:156862862..156862886 21/25 unknown
tropicalis 10.0 Chr9:67599070..67599094 23/25 Antisense target hat1
Chr5:101533348..101533372 21/25 Antisense off-target alpi.1
Chr5:3024150..3024174 21/25 Antisense off-target saysd1
Chr2:67635347..67635371 21/25 unknown
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers