Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252263

Morpholino Name: hdac6 MO1
Synonyms:
Target mRNA: hdac6

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGCACTAGACACAAACAAGTGCAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 24/25
genome
MO
5' GTGCCCTTGTTTGTGTCTAGTGCCC 3'
   |||| ||||||||||||||||||||
3' CACGTGAACAAACACAGATCACGGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:850028..850052 24/25 Antisense target hdac6.L
Chr5S:72716713..72716737 21/25 Antisense off-target bach2.S
Chr2S:104696323..104696347 21/25 Sense off-target gabra5.S
Chr1S:63541609..63541633 21/25 Antisense off-target eif4e1b.S
Chr7S:30981398..30981422 21/25 unknown
Chr7S:31024905..31024929 21/25 unknown
Chr8L:91396521..91396545 21/25 unknown
tropicalis 10.0 Chr1:147663957..147663981 21/25 Sense off-target kiaa1671
Chr8:100112127..100112151 21/25 unknown
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers