Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252267

Morpholino Name: actn1 MO1
Synonyms: MGC81191
Target mRNA: actn1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTGTGCTCCTCATAATGATCCATC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GATGGATCATTATGAGGAGCACAAT 3'
   |||||||||||||||||||||||||
3' CTACCTAGTAATACTCCTCGTGTTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:2747186..2747210 25/25 Antisense target actn1.S
Chr4S:43864458..43864482 21/25 Antisense off-target hnf4b.S
Chr1S:69991671..69991695 21/25 Sense off-target npffr2.S
Chr8S:83151848..83151872 21/25 unknown
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers