Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17252276

Morpholino Name: vangl1 MO1
Synonyms:
Target mRNA: vangl1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTGGTTGGATTCCGTGTCCATATC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 24/25
genome
MO
5' GATATGGACACGGAATCCAACCACT 3'
   |||||||||||||||||||||||||
3' CTATACCTGTGCCTTAGGTTGGTGA 5'
5' GATATGGACACCGAATCCAACCACT 3'
   ||||||||||| |||||||||||||
3' CTATACCTGTGCCTTAGGTTGGTGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:786604..786628 25/25 Antisense target vangl1.L
Chr2S:29229594..29229618 24/25 Antisense target vangl1.S
Chr8L:113189921..113189945 21/25 Sense off-target fut8.L
Chr7S:19838408..19838432 21/25 unknown
tropicalis 10.0 Chr2:1190666..1190690 24/25 Antisense off-target LOC116408733
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers