Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17306974

Morpholino Name: hes4 MO5
Synonyms:
Target mRNA: hes4

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTTCTCCATACTATCTGCAGGCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ATGCCTGCAGATAGTATGGAGAAGC 3'
   |||||||||||||||||||||||||
3' TACGGACGTCTATCATACCTCTTCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:90956868..90956892 25/25 Antisense target hes4.L
Chr3L:144107608..144107632 24/25 Sense off-target gipc1.L
Chr9_10S:60229410..60229434 21/25 Antisense off-target LOC108702264
Chr1S:197205130..197205154 24/25 unknown
Chr5S:118735424..118735448 21/25 unknown
Chr8S:70330432..70330456 21/25 unknown
Publications
First: Functional analysis of Hairy genes in Xenopus neural crest initial specification and cell migration., Dev Dyn 2015                              
Most recent:
View All Papers