Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310724

Morpholino Name: egr4 MO1
Synonyms:
Target mRNA: egr4

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGGCAGGAGAGGTCCATCGTTAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' ATAAGGATGGACCTCTCCTGTCAGG 3'
   |||| ||||||||||||||| ||||
3' TATTGCTACCTGGAGAGGACGGTCC 5'
5' ATAACGATGGACCTCTCCTGCCAGG 3'
   |||||||||||||||||||||||||
3' TATTGCTACCTGGAGAGGACGGTCC 5'
5' ATAACGATGGACCTCTCCTGCCAGG 3'
   |||||||||||||||||||||||||
3' TATTGCTACCTGGAGAGGACGGTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:10095802..10095826 25/25 Antisense target egr4.L
Chr1S:2944927..2944951 25/25 Antisense target egr4.S
Chr9_10S:16778258..16778282 21/25 Antisense off-target eef1a2.S
Chr5S:56650821..56650845 21/25 unknown
tropicalis 10.0 Chr1:16801902..16801926 23/25 Antisense target egr4
Publications
First: A novel function for Egr4 in posterior hindbrain development., Sci Rep 2015                                
Most recent:
View All Papers