Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310725

Morpholino Name: egr4 MO2
Synonyms:
Target mRNA: egr4

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCCTTACCTGACCTGAGCTGAGT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:95527968..95527991 20/24 unknown
tropicalis 10.0 Chr2:7697899..7697922 20/24 unknown
Publications
First: A novel function for Egr4 in posterior hindbrain development., Sci Rep 2015                                
Most recent:
View All Papers