Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310732

Morpholino Name: adam13 MO4
Synonyms: adam13 MO
Target mRNA: adam13

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCTCAGCCGACCCTCCGTCCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 24/25
genome
MO
5' ATGGGGACGGAGGGTTGGCTGCACA 3'
   ||||||||||||||| |||||  ||
3' TACCCCTGCCTCCCAGCCGACTCGT 5'
5' ATGGGGACGGAGGGTCGGATGAGCA 3'
   |||||||||||||||||| ||||||
3' TACCCCTGCCTCCCAGCCGACTCGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:10453570..10453594 24/25 Antisense target adam33.L
Chr1S:3164807..3164831 21/25 Antisense target adam33.S
tropicalis 10.0 Chr1:16305402..16305426 22/25 Antisense target adam33
Chr5:2820129..2820153 21/25 Sense off-target LOC100493854
Publications
First: ADAM13 function is required in the 3 dimensional context of the embryo during cranial neural crest cell migration in Xenopus laevis., Dev Biol 2012                
Most recent: EphrinB2 affects apical constriction in Xenopus embryos and is regulated by ADAM10 and flotillin-1., Nat Commun 2014                    
View All Papers