Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310734

Morpholino Name: efnb2 MO2
Synonyms: B2
Target mRNA: efnb2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GAGTCCCCGCTCAGTGCCATGATCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' AGATCATGGCACTGAGCGGGGACTC 3'
   |||||||||||||||||||||||||
3' TCTAGTACCGTGACTCGCCCCTGAG 5'
5' AGATCATGGCACTGAGCGGGGACTC 3'
   |||||||||||||||||||||||||
3' TCTAGTACCGTGACTCGCCCCTGAG 5'
5' AGATGATGGCACTGAGCGGGGACTC 3'
   |||| ||||||||||||||||||||
3' TCTAGTACCGTGACTCGCCCCTGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:123261525..123261549 25/25 Antisense target efnb2.L
Chr2S:109164882..109164906 24/25 Antisense target efnb2.S
tropicalis 10.0 Chr2:118479186..118479210 25/25 Antisense target efnb2
Chr3:145417919..145417943 21/25 unknown
Publications
First: EphrinB2 affects apical constriction in Xenopus embryos and is regulated by ADAM10 and flotillin-1., Nat Commun 2014                    
Most recent: TBC1d24-ephrinB2 interaction regulates contact inhibition of locomotion in neural crest cell migration., Nat Commun 2018    
View All Papers