Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310737

Morpholino Name: adam10 MO1
Synonyms:
Target mRNA: adam10

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CACGAGCCTCAGCAGTCCCATGATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' GATCATGGCACTGCTGAGGCTCGTG 3'
   |||||||| ||||||||||||||||
3' CTAGTACCCTGACGACTCCGAGCAC 5'
5' GATCATGGGACTGCTGAGGCTCGTG 3'
   |||||||||||||||||||||||||
3' CTAGTACCCTGACGACTCCGAGCAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:54837184..54837208 25/25 Antisense target adam10.S
Chr3L:104644936..104644960 24/25 Antisense off-target LOC108711361
Chr3L:96955371..96955395 23/25 Antisense off-target herc1.L
Chr4L:108815563..108815587 21/25 Sense off-target fndc7.L
Chr4S:11988771..11988795 21/25 Sense off-target c1qtnf4.S
tropicalis 10.0 Chr3:99287095..99287119 24/25 Antisense target adam10
Publications
First: EphrinB2 affects apical constriction in Xenopus embryos and is regulated by ADAM10 and flotillin-1., Nat Commun 2014                    
Most recent:
View All Papers