Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310738

Morpholino Name: adam17 MO1
Synonyms:
Target mRNA: adam17

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CATTTTATTTGTAAGGACCGCTGGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACCAGCGGTCCTTACAAATAAAATG 3'
   |||||||||||||||||||||||||
3' TGGTCGCCAGGAATGTTTATTTTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:148756444..148756468 25/25 Antisense target adam17.L
Chr5L:52434993..52435017 21/25 Sense off-target memo1.L
Chr1S:73906649..73906673 21/25 Sense off-target LOC108706786
Chr8S:96955887..96955911 22/25 unknown
Chr6S:27114178..27114202 21/25 unknown
tropicalis 10.0 Chr7:44379378..44379402 22/25 Sense off-target usp54
Publications
First: EphrinB2 affects apical constriction in Xenopus embryos and is regulated by ADAM10 and flotillin-1., Nat Commun 2014                    
Most recent:
View All Papers