Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310746

Morpholino Name: pax8 MO3
Synonyms:
Target mRNA: pax8

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGCTGCTGTTGGGCATCTTCCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genome
MO
5' GGAGGAAGATGCCCAACAGCAGCAT 3'
   |||||||||||||||||||||||||
3' CCTCCTTCTACGGGTTGTCGTCGTA 5'
5' AGAAGAAGATGCCCAACAGCAGCAT 3'
    || |||||||||||||||||||||
3' CCTCCTTCTACGGGTTGTCGTCGTA 5'
5' GGAGCAAGATGCCCAACAGCAGCAT 3'
   |||| ||||||||||||||||||||
3' CCTCCTTCTACGGGTTGTCGTCGTA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:27512590..27512614 24/25 Antisense target pax8.S
Chr3L:133553994..133554018 23/25 Antisense target pax8.L
Chr3L:3102946..3102970 21/25 Antisense off-target smc1b.L
Chr7S:35640933..35640957 21/25 Sense off-target LOC108697217
Chr7S:13026592..13026616 21/25 unknown
Chr9_10S:81035132..81035156 21/25 unknown
Chr9_10S:81037763..81037787 21/25 unknown
tropicalis 10.0 Chr3:125804973..125804997 25/25 Antisense target pax8
Chr3:3150111..3150135 21/25 Antisense off-target smc1b
Chr1:183499107..183499131 21/25 Antisense off-target arhgef28
Publications
First: Exon capture and bulk segregant analysis: rapid discovery of causative mutations using high-throughput sequencing., BMC Genomics 2012                    
Most recent: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
View All Papers