Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310797

Morpholino Name: vegfa MO3
Synonyms:
Target mRNA: vegfa

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCAGAAAGTTCATGATTTTCCGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ACCGGAAAATCATGAACTTTCTGCC 3'
   |||||||||||||||||||||||||
3' TGGCCTTTTAGTACTTGAAAGACGG 5'
5' ACCGGAAAATCATGAACTTTCTGCC 3'
   |||||||||||||||||||||||||
3' TGGCCTTTTAGTACTTGAAAGACGG 5'
5' ACCGGAAAATCATGAACTTTCTGCC 3'
   |||||||||||||||||||||||||
3' TGGCCTTTTAGTACTTGAAAGACGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:24447060..24447084 25/25 Antisense target vegfa.L
Chr5S:6516447..6516471 25/25 Antisense target vegfa.S
Chr2S:6814773..6814797 21/25 unknown
Chr5L:25859726..25859750 21/25 unknown
tropicalis 10.0 Chr5:1641706..1641730 25/25 Antisense target vegfa
Publications
First: Distinct mechanisms control the timing of differentiation of two myeloid populations in Xenopus ventral blood islands., Dev Growth Differ 2012  
Most recent:
View All Papers