Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310798

Morpholino Name: vegfa MO4
Synonyms:
Target mRNA: vegfa

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGCCTTTTAGTACTTGAAAGACGG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr9:28833939..28833963 21/25 Sense off-target kctd5
Publications
First: Expression and localization of Rdd proteins in Xenopus embryo., Anat Cell Biol 2014            
Most recent:
View All Papers