Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310813

Morpholino Name: serpine2 MO1
Synonyms: PN1.a-MO1
Target mRNA: serpine2

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAGTCAAGTAAGAATACTCCCGGC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: The serpin PN1 is a feedback regulator of FGF signaling in germ layer and primary axis formation., Development 2015                                      
Most recent:
View All Papers