Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310814

Morpholino Name: serpine2 MO2
Synonyms: OB1.a-MO2
Target mRNA: serpine2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTAGTCGCCTCATGATCGTACAAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 23/25
genome
MO
5' GTTGTACGATCATGAGGCGACTAGT 3'
   |||||||||||||||||||||||||
3' CAACATGCTAGTACTCCGCTGATCA 5'
5' GTTCTACGATCATGAGGAGACTAGT 3'
   ||| ||||||||||||| |||||||
3' CAACATGCTAGTACTCCGCTGATCA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:132525506..132525530 25/25 Antisense target serpine2.L
Chr5S:111507608..111507632 23/25 Antisense target serpine2.S
Publications
First: The serpin PN1 is a feedback regulator of FGF signaling in germ layer and primary axis formation., Development 2015                                      
Most recent:
View All Papers