Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311160

Morpholino Name: prickle2 MO2
Synonyms: Pk2-MO#2
Target mRNA: prickle2

Morpholino Type: splice blocking morpholino
Sequence: 5' GAACCCAAACAAACACTTACCTGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' AACAGGTAAGTGTTTGTTTGGGTTC 3'
   |||||||||||||||||||||||||
3' TTGTCCATTCACAAACAAACCCAAG 5'
5' AACAGGTAAGTGTTTGTTTGGGTTC 3'
   |||||||||||||||||||||||||
3' TTGTCCATTCACAAACAAACCCAAG 5'
5' AACAGGTAAGTGTTTGTTTGGGTTC 3'
   |||||||||||||||||||||||||
3' TTGTCCATTCACAAACAAACCCAAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:146203033..146203057 25/25 Antisense target prickle2.L
Chr4S:124286905..124286929 25/25 Antisense target prickle2.S
Chr4L:58154039..58154063 21/25 Antisense off-target plcg2.L
Chr6L:46537941..46537965 21/25 Sense off-target satb1.L
Chr9_10L:83248276..83248300 21/25 unknown
tropicalis 10.0 Chr4:144775055..144775079 25/25 Antisense target prickle2
Chr9:59440248..59440272 21/25 unknown
Publications
First: Control of vertebrate core planar cell polarity protein localization and dynamics by Prickle 2., Development 2015  
Most recent: PCP and Septins govern the polarized organization of the actin cytoskeleton during convergent extension., Curr Biol 2024                  
View All Papers