Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311171

Morpholino Name: vangl1 MO2
Synonyms: vangl1 MO
Target mRNA: vangl1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTGGATTCCGTGTCCATATCTGGTT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 22/25 21/25
genome
MO
5' CTACAGATATGGACACGGAATCCAA 3'
      ||||||||||||||||||||||
3' TTGGTCTATACCTGTGCCTTAGGTT 5'
5' CCACAGATATGGACACCGAATCCAA 3'
      ||||||||||||| ||||||||
3' TTGGTCTATACCTGTGCCTTAGGTT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:786609..786633 22/25 Antisense target vangl1.L
Chr2S:29229589..29229613 21/25 Antisense target vangl1.S
tropicalis 10.0 Chr2:1190671..1190695 21/25 Antisense off-target LOC116408733
Publications
First: Neural crest specification by Prohibitin1 depends on transcriptional regulation of prl3 and vangl1., Genesis 2015                  
Most recent:
View All Papers