Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311303

Morpholino Name: sfrp1 MO5
Synonyms: FrzA, TNeu102i09, XtFrzA.2
Target mRNA: sfrp1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCAGGTCAATACTGAGAGGTTTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 22/25
genome
MO
5' ACAAACCTCTCAGTATTGACCTGAT 3'
   |||||||||||||||||||||||||
3' TGTTTGGAGAGTCATAACTGGACTA 5'
5' ACAAACCTCTCAATAGTCACCTGAT 3'
   |||||||||||| || | |||||||
3' TGTTTGGAGAGTCATAACTGGACTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:26100361..26100385 22/25 Antisense target sfrp1.S
Chr1S:6644429..6644453 22/25 Sense off-target ptpra.S
tropicalis 10.0 Chr3:127008249..127008273 25/25 Antisense target sfrp1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers