Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311333

Morpholino Name: heatr5b MO2
Synonyms: TEgg078i21, XtKIAA1414.2
Target mRNA: heatr5b

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATGATGGCTCTACTGTTCACCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' TTGGTGAACAGTAGAGCCATCATGG 3'
   |||||||||||||||||||||||||
3' AACCACTTGTCATCTCGGTAGTACC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr5:46704233..46704257 25/25 Antisense target heatr5b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers