Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311342

Morpholino Name: serpine2 MO4
Synonyms: TEgg054m19, Xtnexin-1
Target mRNA: serpine2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGATGATTCTACAGCTCAGCAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 24/25
genome
MO
5' TCTGCCGAGCTGTAGAATCATCATG 3'
   ||||| |||||||||||||||||||
3' AGACGACTCGACATCTTAGTAGTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr5:123913195..123913219 24/25 Antisense target serpine2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers