Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311352

Morpholino Name: Nf2 MO1
Synonyms: merlin MO1
Target mRNA: nf2

Morpholino Type: translation blocking morpholino
Sequence: 5' GTAAAATGGCAGAGGCTATCACTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 21/25 25/25
genome
MO
5' GAAGCGATAGCACCTGCCATTTTAA 3'
   |||| ||||||  ||||||||||| 
3' CTTCACTATCGGAGACGGTAAAATG 5'
5' GAAGTGATAGCCTCTGCCATTTTAC 3'
   |||||||||||||||||||||||||
3' CTTCACTATCGGAGACGGTAAAATG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:133858942..133858966 25/25 Sense target nf2.S
Chr1L:79798070..79798094 21/25 Sense off-target LOC108710879
tropicalis 10.0 Chr1:144795925..144795949 21/25 Sense target nf2
Publications
First: NF2/Merlin is required for the axial pattern formation in the Xenopus laevis embryo., Mech Dev 2015                  
Most recent:
View All Papers