Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311353

Morpholino Name: Nf2 MO2
Synonyms: merlin MO2
Target mRNA: nf2

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' AGTTGGTGTTTCATTTATCCAGTGT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' ACACTGGATAAATGAAACACCAACT 3'
   |||||||||||||||||||||||||
3' TGTGACCTATTTACTTTGTGGTTGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:133858965..133858989 25/25 Sense target nf2.S
Chr8L:128740146..128740170 22/25 Sense off-target mindy1.L
Chr4S:38436753..38436777 21/25 Sense off-target cdh11.S
Chr9_10L:115304318..115304342 21/25 Sense off-target atp6v0c.L
Chr2S:88382169..88382193 21/25 unknown
Chr6S:129710023..129710047 21/25 unknown
Chr9_10S:43723699..43723723 21/25 unknown
tropicalis 10.0 Chr2:117219305..117219329 21/25 Sense off-target col4a2
Chr4:43969646..43969670 21/25 unknown
Publications
First: NF2/Merlin is required for the axial pattern formation in the Xenopus laevis embryo., Mech Dev 2015                  
Most recent:
View All Papers