Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311369

Morpholino Name: sccpdh MO1
Synonyms: TGas139h15, Xtnovel19
Target mRNA: sccpdh

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGCTCTGTCGCCATAGTAACTGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 23/25
genome
MO
5' CGCAGTTACTATGGCGACAGAGCGC 3'
   |||||||||||||||||||||||||
3' GCGTCAATGATACCGCTGTCTCGCG 5'
5' CGCAGTTACCATGGCGACAGAGCGT 3'
   ||||||||| |||||||||||||| 
3' GCGTCAATGATACCGCTGTCTCGCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:42597707..42597731 23/25 Antisense target sccpdh.S
Chr5L:52630947..52630971 23/25 Antisense off-target sccpdh.2.L
Chr7L:41933723..41933747 21/25 unknown
Chr7S:53319701..53319725 21/25 unknown
tropicalis 10.0 Chr5:51404255..51404279 25/25 Antisense target sccpdh
Chr7:44728909..44728933 22/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers