Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311400

Morpholino Name: uba5 MO1
Synonyms: TNeu098a04, xtnovel31
Target mRNA: uba5

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCCATTAGTGCTGAATAAGTAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' CCTACTTATTCAGCACTAATGGAGA 3'
   |||||||||||||||||||||||||
3' GGATGAATAAGTCGTGATTACCTCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:65298453..65298477 21/25 Antisense off-target scml4.S
Chr9_10S:7580482..7580506 21/25 Antisense off-target kcnb1.S
Chr1L:74486895..74486919 21/25 Antisense off-target prss12.L
Chr2S:88612904..88612928 21/25 Antisense off-target tmem132e.S
Chr5L:91353911..91353935 21/25 Antisense off-target cyp3a4.2.L
Chr2S:81235511..81235535 21/25 Antisense off-target LOC121400785
Chr3L:132795705..132795729 21/25 Sense off-target LOC108711561
Chr3L:134418155..134418179 21/25 Antisense off-target LOC121401251
Chr8S:60421987..60422011 21/25 Antisense off-target LOC121397710
Chr8S:89020..89044 21/25 Sense off-target LOC108700456
Chr5L:91353911..91353935 21/25 Antisense off-target LOC121393716
Chr5S:55356262..55356286 21/25 Antisense off-target LOC121394226
Chr6S:569104..569128 21/25 Sense off-target LOC121395196
Chr9_10L:46703177..46703201 21/25 Antisense off-target LOC121398160
Chr9_10L:54763878..54763902 21/25 Sense off-target LOC108701219
Chr1L:165049692..165049716 21/25 unknown
Chr1S:121477455..121477479 21/25 unknown
Chr1S:140803068..140803092 21/25 unknown
Chr1S:166898615..166898639 21/25 unknown
Chr1S:93346321..93346345 21/25 unknown
Chr2L:180247361..180247385 21/25 unknown
Chr2S:130367504..130367528 21/25 unknown
Chr8L:73486163..73486187 21/25 unknown
Chr8S:29161133..29161157 21/25 unknown
Chr8S:32583621..32583645 21/25 unknown
Chr3L:48428393..48428417 21/25 unknown
Chr3S:129615931..129615955 21/25 unknown
Chr4L:23916728..23916752 21/25 unknown
Chr4L:30286064..30286088 21/25 unknown
Chr4S:53587595..53587619 21/25 unknown
Chr4S:60823322..60823346 21/25 unknown
Chr7S:55072353..55072377 21/25 unknown
Chr7S:67532046..67532070 21/25 unknown
Chr7S:91401106..91401130 21/25 unknown
Chr9_10L:132194178..132194202 21/25 unknown
Chr9_10L:42870309..42870333 21/25 unknown
Chr9_10L:48239221..48239245 21/25 unknown
tropicalis 10.0 Chr6:52919311..52919335 25/25 Antisense target uba5
Chr5:126127541..126127565 21/25 Antisense off-target crocc2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers