Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311419

Morpholino Name: ubn2 MO1
Synonyms: TEgg140p11, Xtnovel47
Target mRNA: ubn2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGCTCCGCCATTCCTTCCTCTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 21/25
genome
MO
5' GAGAGAGGAAGGAATGGCGGAGCCG 3'
   |||||||||||||||||||||||||
3' CTCTCTCCTTCCTTACCGCCTCGGC 5'
5' GTGTGAAGAAAGAATGGCGGAGCCG 3'
   | | || ||| ||||||||||||||
3' CTCTCTCCTTCCTTACCGCCTCGGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:93638464..93638488 21/25 Antisense target ubn2.S
Chr4L:111818347..111818371 24/25 Antisense off-target LOC108714465
Chr8L:36906266..36906290 21/25 Antisense off-target cul4b.L
Chr6L:102508352..102508376 21/25 unknown
Chr1L:80487834..80487858 21/25 unknown
tropicalis 10.0 Chr4:114757534..114757558 25/25 Antisense target ubn2
Chr4:114757534..114757558 25/25 Sense off-target gucy2c
Chr8:64642591..64642615 21/25 Antisense off-target sytl4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers