Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311421

Morpholino Name: acbd6 MO1
Synonyms: TEgg003f20, Xtnovel48
Target mRNA: acbd6

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGCTGCTGACTCTCGCACTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/24 21/24
genome
MO
5' CTAGTGCGAGAGTCAGCAGCCATG 3'
   ||||||||||||||||||||||||
3' GATCACGCTCTCAGTCGTCGGTAC 5'
5' TTAGTGCGAGGGACAGCAGCCATG 3'
    ||||||||| | |||||||||||
3' GATCACGCTCTCAGTCGTCGGTAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:80644210..80644233 21/24 Antisense target acbd6.S
Chr7S:11425949..11425972 22/24 Antisense off-target ctbp2.S
Chr2L:108322016..108322039 20/24 Sense off-target LOC108708366
tropicalis 10.0 Chr4:101020364..101020387 24/24 Antisense target acbd6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers