Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311427

Morpholino Name: ncaph2 MO2
Synonyms: TEgg019e13, Xtnovel50.2
Target mRNA: ncaph2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTTCTTTACTGAAGGTATGTGCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 22/25
genome
MO
5' AGGCACATACCTTCAGTAAAGTGAG 3'
   |||||||||||||||||||||  | 
3' TCCGTGTATGGAAGTCATTTCTTTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:26285815..26285839 21/25 Antisense off-target sgcd.L
Chr7S:23864039..23864063 21/25 Sense off-target LOC108697196
Chr1L:210607808..210607832 21/25 unknown
Chr4S:17741391..17741415 21/25 unknown
Chr8S:4006201..4006225 21/25 unknown
tropicalis 10.0 Chr3:89408285..89408309 22/25 Antisense target ncaph2
Chr3:89408285..89408309 22/25 Sense off-target lmf2
Chr10:44037974..44037998 21/25 Sense off-target tmem104
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers