Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311429

Morpholino Name: sass6 MO1
Synonyms: TEgg065g15, Xtnovel53
Target mRNA: sass6

Morpholino Type: uncategorized morpholino
Sequence: 5' TACAGAACAGCTCGTCGGCCATAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 23/25
genome
MO
5' GCTATGGCCGACGAGCTGTTCTGTA 3'
   |||||||||||||||||||||||||
3' CGATACCGGCTGCTCGACAAGACAT 5'
5' ACTATGGCCGACGAGTTGTTCTGTA 3'
    |||||||||||||| |||||||||
3' CGATACCGGCTGCTCGACAAGACAT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:147903123..147903147 23/25 Antisense target sass6.L
tropicalis 10.0 Chr1:136785116..136785140 25/25 Antisense target sass6
Chr3:6705307..6705331 21/25 Sense off-target cnot4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers