Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311431

Morpholino Name: sanbr MO1
Synonyms: TEgg056e11, Xtnovel55, kiaa1841 MO1
Target mRNA: sanbr

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTCAGAATATCTGCGACTCATCTTC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 23/25
genome
MO
5' CAAGATGAGTCACAGATATTCTGAA 3'
    |||||||||| |||||||||||||
3' CTTCTACTCAGCGTCTATAAGACTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:32732719..32732743 23/25 Antisense target sanbr.L
Chr3L:181633..181657 21/25 Antisense off-target eps8.L
tropicalis 10.0 Chr5:33759939..33759963 25/25 Antisense off-target kiaa1841
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers