Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311466

Morpholino Name: elk4 MO2
Synonyms: LIG8D09, XtSAP1
Target mRNA: elk4

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGCTATGGACAGTGCTATTACTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 26/26 25/26 24/26
genome
MO
5' AAAGTAATAGCACTGTCCATAGCAAG 3'
   ||||||||||||||||||||||||||
3' TTTCATTATCGTGACAGGTATCGTTC 5'
5' AAAGTAATAGCACTATCCATAGCAAG 3'
   |||||||||||||| |||||||||||
3' TTTCATTATCGTGACAGGTATCGTTC 5'
5' AAAGTGATAGCACTATCCATAGCAAG 3'
   ||||| |||||||| |||||||||||
3' TTTCATTATCGTGACAGGTATCGTTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:66715798..66715823 25/26 Sense target elk4.L
Chr2S:62913308..62913333 24/26 Sense target elk4.S
Chr4S:30432657..30432682 22/26 Antisense off-target tppp3.S
tropicalis 10.0 Chr2:73356991..73357016 26/26 Sense target elk4
Chr4:133270000..133270025 22/26 Antisense off-target slc41a3
Chr6:96531505..96531530 22/26 Sense off-target carmil1
Chr4:10243980..10244005 22/26 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers