Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311467

Morpholino Name: serpina3 MO1
Synonyms: Serpina1, TTpA011h07, Xtserpin-related1
Target mRNA: serpina3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAAATGTAAGGAAGACCCCTCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GATGAGGGGTCTTCCTTACATTTTG 3'
   |||||||||||||||||||||||||
3' CTACTCCCCAGAAGGAATGTAAAAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:168778290..168778314 21/25 Sense off-target LOC108717277
Chr1L:216386100..216386124 21/25 unknown
Chr1S:2490427..2490451 21/25 unknown
tropicalis 10.0 Chr8:88313298..88313322 25/25 Antisense target serpina3
Chr8:144060232..144060256 21/25 Sense off-target s100a16
Chr8:144060338..144060362 21/25 Sense off-target s100a16
Chr9:27977387..27977411 21/25 Antisense off-target prkar1b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers