Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311468

Morpholino Name: serpinb6 MO1
Synonyms: Serpinb8, TGas066i03, Xtserpin-related2
Target mRNA: serpinb6

Morpholino Type: uncategorized morpholino
Sequence: 5' CATTAGCTGCACTTAGGGAATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 23/25
genome
MO
5' ATGGATTCCCTAAGTGCAGCTAATG 3'
   |||||||||||||||||||||||||
3' TACCTAAGGGATTCACGTCGATTAC 5'
5' ATGGATTCCCTTAGTGCAGCGAATG 3'
   ||||||||||| |||||||| ||||
3' TACCTAAGGGATTCACGTCGATTAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:90578318..90578342 23/25 Antisense target serpinb6.L
Chr5L:34032229..34032253 21/25 unknown
Chr6S:113017395..113017419 21/25 unknown
tropicalis 10.0 Chr6:86010155..86010179 25/25 Antisense target serpinb6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers