Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311497

Morpholino Name: vegt MO9
Synonyms: TEgg048b09, XtVegT1
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCTCCATATAAAAACTCTGCTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 23/25
genome
MO
5' TGCAGCAGAGTTTTTATATGGAGCG 3'
   |||||||||||||||||||||||||
3' ACGTCGTCTCAAAAATATACCTCGC 5'
5' TGCAGCAGAGTTTTTATATTGAGCA 3'
   ||||||||||||||||||| |||| 
3' ACGTCGTCTCAAAAATATACCTCGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:165681339..165681363 23/25 Antisense target vegt.L
Chr4L:50857709..50857733 22/25 Antisense off-target LOC108714051
Chr9_10L:70779907..70779931 21/25 Antisense off-target pkp4.L
Chr5S:131668007..131668031 21/25 unknown
Chr7L:27765772..27765796 21/25 unknown
tropicalis 10.0 Chr1:152863141..152863165 25/25 Antisense target vegt
Chr4:37714628..37714652 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers