Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311498

Morpholino Name: vegt MO10
Synonyms: TEgg048b09, XtVegT1.2
Target mRNA: vegt

Morpholino Type: translation blocking morpholino
Sequence: 5' TGTGTTCCTGACAGCAGTTTCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25 21/25
genome
MO
5' ATGAGAAACTGCTGTCAGGAACACA 3'
   |||||||||||||||||||||||||
3' TACTCTTTGACGACAGTCCTTGTGT 5'
5' ATGAGAAACTGCTGTCGGGAATGCG 3'
   |||||||||||||||| ||||  | 
3' TACTCTTTGACGACAGTCCTTGTGT 5'
5' ATGAGAAACTGCTGTCGGGAACGTG 3'
   |||||||||||||||| |||||   
3' TACTCTTTGACGACAGTCCTTGTGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:165681268..165681292 21/25 Antisense target vegt.L
Chr1S:142004124..142004148 21/25 Antisense target vegt.S
Chr9_10L:98186758..98186782 21/25 Antisense off-target LOC108701515
Chr8S:6331326..6331350 21/25 unknown
tropicalis 10.0 Chr1:152863070..152863094 25/25 Antisense target vegt
Chr8:51640943..51640967 21/25 Antisense off-target dcx
Chr3:125527891..125527915 21/25 Antisense off-target polm
Chr3:125527891..125527915 21/25 Sense off-target h2az2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers