Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17327606

Morpholino Name: bmpr1a MO1
Synonyms: ALK3 MO1
Target mRNA: bmpr1a

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCTTGAAGAAGTATGCTCGCCTTT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 24/25
genome
MO
5' GAAGGCGAGCATACTTCTTCAAGAA 3'
    ||||||||||||||||||||||||
3' TTTCCGCTCGTATGAAGAAGTTCTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:38646091..38646115 24/25 Antisense target bmpr1a.S
Publications
First: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development., BMC Dev Biol 2016                            
Most recent:
View All Papers