Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17327607

Morpholino Name: bmpr1a MO2
Synonyms: ALK3 MO2
Target mRNA: bmpr1a

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACCAACCCATCCCTTGTGCCGGA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:65003729..65003753 25/25 Antisense off-target bmpr1b.S
Chr1L:80881804..80881828 24/25 Antisense off-target bmpr1b.L
Chr5S:21318105..21318129 21/25 unknown
Publications
First: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development., BMC Dev Biol 2016                            
Most recent:
View All Papers